Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLNCX2-NGN2-IRES-GFP
(Plasmid #90212)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 90212 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NGN2-IRES-GFP
  • Species
    H. sapiens (human)
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer cctcacattgccaaaagacg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLNCX2-NGN2-IRES-GFP was a gift from Chun-Li Zhang (Addgene plasmid # 90212 ; http://n2t.net/addgene:90212 ; RRID:Addgene_90212)
  • For your References section:

    Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic neurons. Liu ML, Zang T, Zou Y, Chang JC, Gibson JR, Huber KM, Zhang CL. Nat Commun. 2013;4:2183. doi: 10.1038/ncomms3183. 10.1038/ncomms3183 PubMed 23873306