Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pJG486
(Plasmid #91195)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 91195 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRANS_203
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nTaCas9_H840A+gUbi1+donor
  • gRNA/shRNA sequence
    gUbi1: GCTGGTGCAACTGGTGGCCC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJG486 was a gift from Daniel Voytas (Addgene plasmid # 91195 ; http://n2t.net/addgene:91195 ; RRID:Addgene_91195)
  • For your References section:

    A multi-purpose toolkit to enable advanced genome engineering in plants. Cermak T, Curtin SJ, Gil-Humanes J, Cegan R, Kono TJY, Konecna E, Belanto JJ, Starker CG, Mathre JW, Greenstein RL, Voytas DF. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922. 10.1105/tpc.16.00922 PubMed 28522548