-
PurposeExpresses active LwCas13a for mammalian RNA targeting with Blasticidin selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
- Backbone size w/o insert (bp) 8216
- Total vector size (bp) 13058
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLwCas13a
-
Alt nameLwaCas13a
-
Alt nameLwC2c2
-
Alt nameCas13a
-
SpeciesLeptotrichia wadei
-
Insert Size (bp)4842
- Promoter EFS
-
Tags
/ Fusion Proteins
- msfGFP-NLS-3xHA, P2A, Blasticidin (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctaggtcttgaaaggagtggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC034 - LwCas13a-msfGFP-2A-Blast was a gift from Feng Zhang (Addgene plasmid # 91924 ; http://n2t.net/addgene:91924 ; RRID:Addgene_91924) -
For your References section:
RNA targeting with CRISPR-Cas13. Abudayyeh OO, Gootenberg JS, Essletzbichler P, Han S, Joung J, Belanto JJ, Verdine V, Cox DBT, Kellner MJ, Regev A, Lander ES, Voytas DF, Ting AY, Zhang F. Nature. 2017 Oct 4. doi: 10.1038/nature24049. 10.1038/nature24049 PubMed 28976959