This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TRE-ChrimsonR-mCherry
(Plasmid #92207)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92207 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV vector
  • Backbone size w/o insert (bp) 4037
  • Total vector size (bp) 6211
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChimsonR-mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    1830
  • Promoter TRE

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcggccgcACGCGTccttc
  • 3′ sequencing primer CATAGTTAAGAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRE-ChrimsonR-mCherry was a gift from Alice Ting (Addgene plasmid # 92207)
  • For your References section:

    A light- and calcium-gated transcription factor for imaging and manipulating activated neurons. Wang W, Wildes CP, Pattarabanjird T, Sanchez MI, Glober GF, Matthews GA, Tye KM, Ting AY. Nat Biotechnol. 2017 Jun 26. doi: 10.1038/nbt.3909. 10.1038/nbt.3909 PubMed 28650461