Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #92213)


Item Catalog # Description Quantity Price (USD)
Plasmid 92213 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    AAV vector
  • Backbone size w/o insert (bp) 3659
  • Total vector size (bp) 6374
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    NRX-TM-Nav1.6 -CaMbp(M2)-eLOV-TEVcs(ENLYFQ▲M)-tTA-VP16
  • Species
  • Insert Size (bp)
  • Promoter synapsin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGACCATCTGCGCTGCGGCGCC
  • 3′ sequencing primer GGCGCGCCagcgctgctcgag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ca-FLARE (TF) was a gift from Alice Ting (Addgene plasmid # 92213 ; ; RRID:Addgene_92213)
  • For your References section:

    A light- and calcium-gated transcription factor for imaging and manipulating activated neurons. Wang W, Wildes CP, Pattarabanjird T, Sanchez MI, Glober GF, Matthews GA, Tye KM, Ting AY. Nat Biotechnol. 2017 Jun 26. doi: 10.1038/nbt.3909. 10.1038/nbt.3909 PubMed 28650461