This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV2_hSyn_Aurora_Citrine
(Plasmid #98217)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98217 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic construct Aurora gene
  • Alt name
    Aurora
  • Alt name
    ReaChR, bReachEs
  • Species
    Synthetic; Chlamydomonas reinhardtii, Volvox carteri
  • Insert Size (bp)
    915
  • Mutation
    V59S, E83N, E90Q, E101S, V117R, E123S, P242R, A246N, N258Q, E273S
  • Promoter human synapsin
  • Tag / Fusion Protein
    • Citrine (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer TGAACAGCTCCTCGCCCTTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV2_hSyn_Aurora_Citrine was a gift from Simon Wiegert (Addgene plasmid # 98217)
  • For your References section:

    Artificial anion-conducting channelrhodopsins with tuned spectra, modified kinetics and enhanced light sensitivity. Wietek, Jonas, Silvia Rodriguez-Rozada, Janine Tutas, Federico Tenedini, Christiane Grimm, Thomas Oertner, Peter Soba, Peter Hegemann, J. Simon Wiegert. biorxiv /10.1101/156422