Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #98218)


Item Catalog # Description Quantity Price (USD)
Plasmid 98218 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Synthetic construct Phobos_C128A gene
  • Alt name
  • Alt name
  • Species
    Synthetic; Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Mutation
    T59S, E83N, E90Q, E101S, V117R, E123S, C128A, T159G, G163A, V242R, T246N, N258Q, E273S
  • Promoter human synapsin
  • Tag / Fusion Protein
    • Citrine (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer TGAACAGCTCCTCGCCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV2_hSyn_Phobos_CA_Citrine was a gift from Simon Wiegert (Addgene plasmid # 98218 ; ; RRID:Addgene_98218)
  • For your References section:

    Anion-conducting channelrhodopsins with tuned spectra and modified kinetics engineered for optogenetic manipulation of behavior. Wietek J, Rodriguez-Rozada S, Tutas J, Tenedini F, Grimm C, Oertner TG, Soba P, Hegemann P, Wiegert JS. Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y. 10.1038/s41598-017-14330-y [pii] PubMed 29097684