Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

VV221: sdChR(C138S)-TS-eGFP-ER in fck
(Plasmid #58513)


Item Catalog # Description Quantity Price (USD)
Plasmid 58513 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    FCK(1.3)GW, from Addgene 22217
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10059
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number


  • Gene/Insert name
  • Alt name
    Channelrhodopsin from Scherffelia dubia
  • Species
    Scherffelia dubia
  • Insert Size (bp)
  • Mutation
    changed Cysteine 138 to Serine
  • Promoter a-CamKII
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this gene (sdChR) from Nathan Klapoetke in the Boyden Lab at MIT; we made the C138S point mutation in sdChR and cloned it into the fck vector. Note that C138 in sdChR is homologous to C128 in ChR2; the ChR2(C128S) point mutant was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

sdChR was published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV221: sdChR(C138S)-TS-eGFP-ER in fck was a gift from Adam Cohen (Addgene plasmid # 58513 ; ; RRID:Addgene_58513)
  • For your References section:

    Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307