Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmEos2-Linker_PCNA-MutC
(Plasmid #98272)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98272 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    C2
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression
  • Selectable markers
    mEos2

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    782
  • Mutation
    Silent mutated Sequence: GACGCCGTAGTTATATCTTGC (Original: GATGCTGTTGTAATTTCCTGT)
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mEos2 (N terminal on insert)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid encodes a second insert: mEos2 (from Lobophyllia hemprichii). A glycine-rich linker sequence (GEGQGQGQGPGRGYAYRS), which was reported to be necessary for cell line generation, was inserted as a spacer between mEos2 and PCNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmEos2-Linker_PCNA-MutC was a gift from Mike Heilemann (Addgene plasmid # 98272 ; http://n2t.net/addgene:98272 ; RRID:Addgene_98272)
  • For your References section:

    PCNA appears in two populations of slow and fast diffusion with a constant ratio throughout S-phase in replicating mammalian cells. Zessin PJ, Sporbert A, Heilemann M. Sci Rep. 2016 Jan 13;6:18779. doi: 10.1038/srep18779. 10.1038/srep18779 PubMed 26758689