lentiCRISPRv2 blast
(Plasmid #98293)

• Purpose: (Empty Backbone) Variant of lentiCRISPRv2 that confers blasticidin S resistance
• Depositing Lab: Brett Stringer
• Publication: Stringer et al Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z.

Backbone

• Vector backbone: lentiCRISPRv2
• Backbone manufacturer: Feng Zhang (Addgene #52961)
• Backbone size (bp): 14676
• Vector type: Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: P2a-blast
• Promoter: EF-1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CCAAAGAGGTGCTGGACG
• 3′ sequencing primer: WPRE-R (CATAGCGTAAAAGGAGCAACA)

Resource Information

• Supplemental Documents:
  • lentiCRISPRv2 plasmid design
  • Cloning protocol
• Articles Citing this Plasmid:
  • 34 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Double stranded oligonucleotides encoding sgRNA sequences can be cloned between the BsmBI restriction sites as for lentiCRISPRv2. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide.

We recommend screening multiple colonies to ensure the plasmid has been isolated correctly.

Information for Cloning Grade DNA (Catalog # 98293-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here