Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #98322)


Item Catalog # Description Quantity Price (USD)
Plasmid 98322 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    David Root (Addgene plasmid # 41392)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    BRAF (a.k.a. B-RAF1, B-raf, BRAF1, NS7, RAFB1)
  • Promoter E1Fa
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCGTGAG
  • 3′ sequencing primer GTGGATACGCTGCTTTAATGCCTT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BRAF_pLX307 was a gift from William Hahn & Sefi Rosenbluh (Addgene plasmid # 98322 ; ; RRID:Addgene_98322)
  • For your References section:

    Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers. Rosenbluh J, Mercer J, Shrestha Y, Oliver R, Tamayo P, Doench JG, Tirosh I, Piccioni F, Hartenian E, Horn H, Fagbami L, Root DE, Jaffe J, Lage K, Boehm JS, Hahn WC. Cell Syst. 2016 Sep 28;3(3):302-316.e4. doi: 10.1016/j.cels.2016.09.001. 10.1016/j.cels.2016.09.001 PubMed 27684187