Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pZE21/UBP1/ClpS
(Plasmid #98566)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98566 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZE21
  • Backbone manufacturer
    Expressys
  • Backbone size w/o insert (bp) 2200
  • Total vector size (bp) 4696
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Note that this plasmid does not contain the Tet repressor and thus inducible expression only occurs in hosts that express the Tet repressor (such as C321.deltaA strains)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Truncated ubiquitin cleavase, codon optimized
  • Alt name
    UBP1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2151
  • Mutation
    Removed the first 98 amino acids that encode transmembrane domains to improve yield as was done in literature (Wojtowicz et al, Microb Cell Fact, 2005, DOI: 10.1186/1475-2859-4-17)
  • Promoter Tet promoter (aTc inducer)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCATTATTATCATGACATTAACC
  • 3′ sequencing primer TATCACTTTATACATAGATG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ATP-dependent Clp protease adapter protein
  • Alt name
    ClpS
  • Species
    Escherichia coli
  • Insert Size (bp)
    318
  • Mutation
    In a synthetic operon downstream of UBP1
  • Promoter Same as UBP1 (operon)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGACATTTCAGGGAAGGATG
  • 3′ sequencing primer GGATTTGTCCTACTCAGGAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Addgene NGS results found that the second tet operator in the tet promoter is missing; however the depositing laboratory confirmed that the plasmid functions normally

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZE21/UBP1/ClpS was a gift from George Church (Addgene plasmid # 98566 ; http://n2t.net/addgene:98566 ; RRID:Addgene_98566)
  • For your References section:

    Engineering posttranslational proofreading to discriminate nonstandard amino acids. Kunjapur AM, Stork DA, Kuru E, Vargas-Rodriguez O, Landon M, Soll D, Church GM. Proc Natl Acad Sci U S A. 2018 Jan 16;115(3):619-624. doi: 10.1073/pnas.1715137115. Epub 2018 Jan 4. 10.1073/pnas.1715137115 PubMed 29301968