pZE21/UBP1/ClpS
(Plasmid #98566)

• Purpose: Expresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operon
• Depositing Lab: George Church
• Publication: Kunjapur et al Proc Natl Acad Sci U S A. 2018 Jan 16;115(3):619-624. doi: 10.1073/pnas.1715137115. Epub 2018 Jan 4.

Backbone

• Vector backbone: pZE21
• Backbone manufacturer: Expressys
• Backbone size w/o insert (bp): 2200
• Total vector size (bp): 4696
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Note that this plasmid does not contain the Tet repressor and thus inducible expression only occurs in hosts that express the Tet repressor (such as C321.deltaA strains)
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Truncated ubiquitin cleavase, codon optimized
• Alt name: UBP1
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2151
• Mutation: Removed the first 98 amino acids that encode transmembrane domains to improve yield as was done in literature (Wojtowicz et al, Microb Cell Fact, 2005, DOI: 10.1186/1475-2859-4-17)
• Promoter: Tet promoter (aTc inducer)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCATTATTATCATGACATTAACC
• 3′ sequencing primer: TATCACTTTATACATAGATG

Gene/Insert 2

• Gene/Insert name: ATP-dependent Clp protease adapter protein
• Alt name: ClpS
• Species: Escherichia coli
• Insert Size (bp): 318
• Mutation: In a synthetic operon downstream of UBP1
• Promoter: Same as UBP1 (operon)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGACATTTCAGGGAAGGATG
• 3′ sequencing primer: GGATTTGTCCTACTCAGGAG

Resource Information

• Supplemental Documents:
  • pze-ubp1-clps.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS results found that the second tet operator in the tet promoter is missing; however the depositing laboratory confirmed that the plasmid functions normally