Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LentiCRISPRv2-Beclin1
(Plasmid #99574)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99574 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting Beclin1
  • gRNA/shRNA sequence
    CACCGATCTGCGAGAGACACCATCC
  • Species
    H. sapiens (human)
  • Entrez Gene
    BECN1 (a.k.a. ATG6, VPS30, beclin1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-Beclin1 was a gift from Edward Campbell (Addgene plasmid # 99574 ; http://n2t.net/addgene:99574 ; RRID:Addgene_99574)
  • For your References section:

    TRIM5alpha degradation via autophagy is not required for retroviral restriction. Imam S, Talley S, Nelson RS, Dharan A, O'Connor C, Hope TJ, Campbell EM. J Virol. 2016 Jan 13. pii: JVI.03033-15. 10.1128/JVI.03033-15 PubMed 26764007