plko.1/shMCT4 477
(Plasmid
#99598)
-
PurposeKnockdown of MCT4 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99598 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplko.1
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCT4
-
gRNA/shRNA sequenceCCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_004207
-
Entrez GeneSLC16A3 (a.k.a. MCT 3, MCT 4, MCT-3, MCT-4, MCT3, MCT4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plko.1/shMCT4 477 was a gift from Eli Bar (Addgene plasmid # 99598 ; http://n2t.net/addgene:99598 ; RRID:Addgene_99598) -
For your References section:
Inhibition of monocarboxylate transporter-4 depletes stem-like glioblastoma cells and inhibits HIF transcriptional response in a lactate-independent manner. Lim KS, Lim KJ, Price AC, Orr BA, Eberhart CG, Bar EE. Oncogene. 2014 Aug 28;33(35):4433-41. doi: 10.1038/onc.2013.390. Epub 2013 Sep 30. 10.1038/onc.2013.390 PubMed 24077291