|
|
183158 |
pUC19/Vc-C |
|
Zhu |
Apr 26, 2022 |
|
|
167703 |
BirA-Myc_N_FOXL1 |
FOXL1 (Homo sapiens)
|
Varjosalo |
Apr 26, 2022 |
|
|
176710 |
pYCTK006 |
P-SST2 (Saccharomyces cerevisiae)
|
Sourjik |
Apr 26, 2022 |
|
|
183157 |
pUC19/N-Vc |
|
Zhu |
Apr 26, 2022 |
|
|
167702 |
BirA-Myc_N_FOXI1 |
FOXI1 (Homo sapiens)
|
Varjosalo |
Apr 26, 2022 |
|
|
183160 |
pUC19/mChe-C |
|
Zhu |
Apr 26, 2022 |
|
|
183159 |
pUC19/N-mChe |
|
Zhu |
Apr 26, 2022 |
|
|
167700 |
BirA-Myc_N_ETS1 |
ETS1 (Homo sapiens)
|
Varjosalo |
Apr 26, 2022 |
|
|
183155 |
pUC19/N-eCFP |
|
Zhu |
Apr 26, 2022 |
|
|
184464 |
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 |
PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (Homo sapiens)
|
Doudna |
Apr 26, 2022 |
|
|
172092 |
IMPT-2070 |
Homo sapiens adenosine A2a receptor (ADORA2A) (Homo sapiens)
|
Stevens |
Apr 26, 2022 |
|
|
183054 |
pGL3 RARE-RFP |
RFP
|
Kalcheim |
Apr 26, 2022 |
|
|
183055 |
pGL3 RARE-d2EGFP |
d2EGFP
|
Kalcheim |
Apr 26, 2022 |
|
|
182497 |
pTET GFP10-FRB/FKBP-GFP11 |
FRB (Homo sapiens), FKBP (Mus musculus)
|
Cabantous |
Apr 26, 2022 |
|
|
180000 |
pKB233.3 |
mNeonGreen (Other)
|
Tabor |
Apr 26, 2022 |
|
|
181976 |
pLeGO.sgGata1.4.RUNX1A.iG2 |
GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens)
|
Klusmann |
Apr 26, 2022 |
|
|
180001 |
pKB233.4 |
mNeonGreen (Other)
|
Tabor |
Apr 26, 2022 |
|
|
181970 |
pOT_1 - lenti-EFS-LTBR-2A-puro |
LTBR (Homo sapiens)
|
Sanjana |
Apr 25, 2022 |
|
|
181971 |
pOT_2 - lenti-EFS-tNGFR-2A-puro |
tNGFR (Homo sapiens)
|
Sanjana |
Apr 25, 2022 |
|
|
181972 |
pOT_3 - lenti-EFS-FMC6.3-28z-2A-puro-2A-LTBR |
FMC6.3-28z CAR; LTBR (Homo sapiens)
|
Sanjana |
Apr 25, 2022 |
|
|
181973 |
pOT_4 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-LTBR |
FMC6.3-BBz CAR; LTBR (Homo sapiens)
|
Sanjana |
Apr 25, 2022 |
|
|
181974 |
pOT_5 - lenti-EFS-FMC6.3-28z-2A-puro-2A-tNGFR |
FMC6.3-28z CAR; tNGFR (Homo sapiens)
|
Sanjana |
Apr 25, 2022 |
|
|
181975 |
pOT_6 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-tNGFR |
FMC6.3-BBz CAR; tNGFR (Homo sapiens)
|
Sanjana |
Apr 25, 2022 |
|
|
179999 |
pKB233.2 |
mNeonGreen (Other)
|
Tabor |
Apr 25, 2022 |
|
|
180608 |
pJJGL004 |
PlmCasX with DpbCasX R1 loop (Other)
|
Doudna |
Apr 25, 2022 |
|
|
180514 |
pCAT527 |
CasX sgRNAv2, PlmCasX with DpbCasX R1 loop-2A-mNeonGreen (Other)
|
Doudna |
Apr 25, 2022 |
|
|
180605 |
pJJGL001 |
DpbCasX
|
Doudna |
Apr 25, 2022 |
|
|
180606 |
pJJGL002 |
PlmCasX (Other)
|
Doudna |
Apr 25, 2022 |
|
|
180607 |
pJJGL003 |
DpbCasX with R3 loop
|
Doudna |
Apr 25, 2022 |
|
|
180510 |
pCAT105 |
CasX sgRNAv2, DpbCasX with R3 loop
|
Doudna |
Apr 25, 2022 |
|
|
180511 |
pCAT077 |
CasX sgRNAv2, PlmCasX (Other)
|
Doudna |
Apr 25, 2022 |
|
|
180512 |
pCAT100 |
CasX sgRNAv2, PlmCasX with DpbCasX R1 loop (Other)
|
Doudna |
Apr 25, 2022 |
|
|
180513 |
pCAT526 |
CasX sgRNAv1, PlmCasX-2A-mNeonGreen
|
Doudna |
Apr 25, 2022 |
|
|
183900 |
TALED_Right-ND1-AD |
TALED for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183899 |
TALED_Right-ND1-1397N-UGI |
DDCBE for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183898 |
TALED_Right-ND1-1397N |
TALED for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183897 |
TALED_Right-RNR2-1397N |
TALED for RNR2 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183896 |
TALED_Left-RNR2-1397C-AD |
TALED for RNR2 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183895 |
TALED_Left-ND1-E1347A |
TALED for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183894 |
TALED_Left-ND1-AD-E1347A |
TALED for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
179998 |
pKB233.1 |
mNeonGreen (Other)
|
Tabor |
Apr 25, 2022 |
|
|
183893 |
TALED_Left-ND1-1397C-UGI |
DDCBE for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
183892 |
TALED_Left-ND1-1397C-AD |
TALED for ND1 mutation (Synthetic)
|
Kim |
Apr 25, 2022 |
|
|
180473 |
pQFDBD-2x AD*-VP16*, α-cry:EGFP |
QFDBD-2xQFAD*-VP16* (Synthetic)
|
Ro |
Apr 25, 2022 |
|
|
182575 |
pαH-S-GSAS-B.1.617.2.v1 |
Spike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (Other)
|
Acharya |
Apr 25, 2022 |
|
|
183448 |
pFUGW NLS-FlpO |
NLS-FlpO (Synthetic)
|
MacGillavry |
Apr 25, 2022 |
|
|
183425 |
pFUGW NLS-Cre |
NLS-Cre (Synthetic)
|
MacGillavry |
Apr 25, 2022 |
|
|
183423 |
pOC4 cloning template vector |
|
MacGillavry |
Apr 25, 2022 |
|
|
183443 |
pORANGE Tubb3-2xGFP KI |
gRNA and 2xGFP donor (Mus musculus)
|
MacGillavry |
Apr 25, 2022 |
|
|
183420 |
pOC1 cloning template vector |
|
MacGillavry |
Apr 25, 2022 |
