Skip to main content

pcDNA3-teLuc c-myc
(Plasmid #100026)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100026 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 100026-D50 50 μg of DNA in Tris buffer $495
DNA 100026-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6000
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    teLuc, a NanoLuc mutant
  • Species
    Synthetic
  • Insert Size (bp)
    555
  • Mutation
    D19S, D85N, C164H
  • GenBank ID
    KX963378
  • Promoter CMV
  • Tag / Fusion Protein
    • c-myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see https://med.virginia.edu/ai-lab/samples/ for Practical Notes describing the use of this plasmid.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-teLuc c-myc was a gift from Huiwang Ai (Addgene plasmid # 100026 ; http://n2t.net/addgene:100026 ; RRID:Addgene_100026)
  • For your References section:

    Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging. Yeh HW, Karmach O, Ji A, Carter D, Martins-Green MM, Ai HW. Nat Methods. 2017 Sep 4. doi: 10.1038/nmeth.4400. 10.1038/nmeth.4400 PubMed 28869756