-
PurposeA BRET based CyOFP-teLuc-CyOFP fusion to further red-shift bioluminescence
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Riverside
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 100027-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 100027-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 7369
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAntares2
-
SpeciesSynthetic
-
Insert Size (bp)1923
-
GenBank IDKY474379
- Promoter CMV
-
Tag
/ Fusion Protein
- c-myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see https://med.virginia.edu/ai-lab/samples/ for Practical Notes describing the use of this plasmid.
DNA (Catalog # 100027-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 100027-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Antares2 c-myc was a gift from Huiwang Ai (Addgene plasmid # 100027 ; http://n2t.net/addgene:100027 ; RRID:Addgene_100027) -
For your References section:
Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging. Yeh HW, Karmach O, Ji A, Carter D, Martins-Green MM, Ai HW. Nat Methods. 2017 Sep 4. doi: 10.1038/nmeth.4400. 10.1038/nmeth.4400 PubMed 28869756