Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3-teLuc c-myc
(Plasmid #100026)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100026 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6000
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    teLuc, a NanoLuc mutant
  • Species
    Synthetic
  • Insert Size (bp)
    555
  • Mutation
    D19S, D85N, C164H
  • GenBank ID
    KX963378
  • Promoter CMV
  • Tag / Fusion Protein
    • c-myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see https://med.virginia.edu/ai-lab/samples/ for Practical Notes describing the use of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-teLuc c-myc was a gift from Huiwang Ai (Addgene plasmid # 100026 ; http://n2t.net/addgene:100026 ; RRID:Addgene_100026)
  • For your References section:

    Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging. Yeh HW, Karmach O, Ji A, Carter D, Martins-Green MM, Ai HW. Nat Methods. 2017 Sep 4. doi: 10.1038/nmeth.4400. 10.1038/nmeth.4400 PubMed 28869756