pET28b-hTIG3-1-164
(Plasmid #100724)

• Purpose: Full-length human TIG3 in E.coli expression vector
• Depositing Lab: Byung Il Lee
• Publication: Han et al Protein Expr Purif. 2010 May;71(1):103-7. doi: 10.1016/j.pep.2010.01.018. Epub 2010 Jan 25.

Backbone

• Vector backbone: pET28b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5200
• Total vector size (bp): 5700
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RARRES3
• Alt name: RIG1
• Alt name: TIG3
• Species: H. sapiens (human)
• Insert Size (bp): 500
• Entrez Gene: PLAAT4 (a.k.a. HRASLS4, HRSL4, PLA1/2-3, PLAAT-4, RARRES3, RIG1, TIG3)
• Promoter: T7 promotor
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG (T7 promoter primer)
• 3′ sequencing primer: CCGCTGAGCAATAACTAGC (T7 terminator primer)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry