-
PurposeLuciferase reporter plasmid containing three tandem repeats of the unfolded protein response element (UPRE)
-
Depositing Lab
-
Depositing OrganizationTokushima University
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 101788-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 101788-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL4.29
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xUPRE
-
SpeciesSynthetic
-
Insert Size (bp)87
- Promoter minimal TATA-box promoter with low basal activity
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer ctaactggccggtacctgag
- 3′ sequencing primer aacagtaccggattgccaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 101788-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 101788-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-UPRE-luc2P-Hygro was a gift from Seiichi Oyadomari (Addgene plasmid # 101788 ; http://n2t.net/addgene:101788 ; RRID:Addgene_101788) -
For your References section:
Dkk3/REIC, an N-glycosylated Protein, Is a Physiological Endoplasmic Reticulum Stress Inducer in the Mouse Adrenal Gland. Fujita H, Bando T, Oyadomari S, Ochiai K, Watanabe M, Kumon H, Ohuchi H. Acta Med Okayama. 2020 Jun;74(3):199-208. doi: 10.18926/AMO/59950. 10.18926/AMO/59950 PubMed 32577017