Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLVX-XBP1 mNeonGreen NLS
(Plasmid #115968)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115968 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX-Puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8102
  • Total vector size (bp) 9163
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    X-box binding protein 1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1061
  • Entrez Gene
    XBP1 (a.k.a. TREB-5, TREB5, XBP-1, XBP2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA tag (N terminal on insert)
    • mNeonGreen (C terminal on insert)
    • c-myc NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This sensor leads to the expression of a mNeonGreen fusion protein in the nucleus upon induction of ER-stress. ER-stress kinetic through the IRE1/XBP1 pathway can thus be monitored by recording the green fluorescent signal arising in the nucleus.
Designed by Adrien Nougarède.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-XBP1 mNeonGreen NLS was a gift from David Andrews (Addgene plasmid # 115968 ; http://n2t.net/addgene:115968 ; RRID:Addgene_115968)
  • For your References section:

    Improved IRE1 and PERK Pathway Sensors for Multiplex Endoplasmic Reticulum Stress Assay Reveal Stress Response to Nuclear Dyes Used for Image Segmentation. Nougarede A, Tesniere C, Ylanko J, Rimokh R, Gillet G, Andrews DW. Assay Drug Dev Technol. 2018 Aug 8. doi: 10.1089/adt.2018.862. 10.1089/adt.2018.862 PubMed 30088945