-
PurposeER-stress sensor - ATF4 translation at ORF3 fluorescent reporter with mScarlet-I (retroviral vector backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLHCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6813
- Total vector size (bp) 7991
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameactivating transcription factor 4
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1178
-
Entrez GeneATF4 (a.k.a. CREB-2, CREB2, TAXREB67, TXREB)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA tag (N terminal on insert)
- mScarlet-I (C terminal on insert)
- c-myc NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This sensor leads to the expression of a mScarlet-I fusion protein in the nucleus upon induction of ER-stress. ER-stress kinetic through the PERK/ATF4 pathway can thus be monitored by recording the red fluorescent signal arising in the nucleus.
Designed by Adrien Nougarède.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLHCX-ATF4 mScarlet NLS was a gift from David Andrews (Addgene plasmid # 115970 ; http://n2t.net/addgene:115970 ; RRID:Addgene_115970) -
For your References section:
Improved IRE1 and PERK Pathway Sensors for Multiplex Endoplasmic Reticulum Stress Assay Reveal Stress Response to Nuclear Dyes Used for Image Segmentation. Nougarede A, Tesniere C, Ylanko J, Rimokh R, Gillet G, Andrews DW. Assay Drug Dev Technol. 2018 Aug 8. doi: 10.1089/adt.2018.862. 10.1089/adt.2018.862 PubMed 30088945