Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p5xATF6-GL3
(Plasmid #11976)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11976 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pOFluc-GL3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5xATF6 binding site
  • Tags / Fusion Proteins
    • Luc (C terminal on backbone)
    • c-fos promoter (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer NA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5 repeats of the ATF6 oligonucleotides were cloned into pOFluc-GL3 at an XhoI site 5' to the c-fos minimal promoter (-53 to +45 of the human c-fos promoter) and the firefly luciferase gene. See author's map for detail.

Oligo seq is - 5'- TCGAGACAGGTGCTGACGTGGCGATTCC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p5xATF6-GL3 was a gift from Ron Prywes (Addgene plasmid # 11976 ; http://n2t.net/addgene:11976 ; RRID:Addgene_11976)
  • For your References section:

    Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response. Wang Y, Shen J, Arenzana N, Tirasophon W, Kaufman RJ, Prywes R. J Biol Chem. 2000 Sep 1. 275(35):27013-20. 10.1074/jbc.M003322200 PubMed 10856300