-
PurposeFor visualization of ATF6 in mammalian cells with a mutation in ATF6 that blocks cleavage by protease S1P. Activated protein will remain in the Golgi.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATF6
-
SpeciesH. sapiens (human)
-
MutationS1Protease site mutation: R415A/R416A
-
Entrez GeneATF6 (a.k.a. ACHM7, ATF6A, ATP6alpha)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer hATF6-R (gaacccatcctcgaagttca)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
During sequencing a change of Methionine 67 to Leucine, and Methionine 313 to Isoleucine was detected. This change in the basic region should not affect experiments with this construct, but could affect DNA binding by derivatives made from this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-ATF6-(S1P-) was a gift from Ron Prywes (Addgene plasmid # 32956 ; http://n2t.net/addgene:32956 ; RRID:Addgene_32956) -
For your References section:
The luminal domain of ATF6 senses endoplasmic reticulum (ER) stress and causes translocation of ATF6 from the ER to the Golgi. Chen X, Shen J, Prywes R. J Biol Chem. 2002 Apr 12. 277(15):13045-52. 10.1074/jbc.M110636200 PubMed 11821395