Skip to main content
Addgene
Open Menu

ET8-GPIba-6His
(Plasmid #102878)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102878 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 102878-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 102878-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    ET8
  • Backbone size w/o insert (bp) 5374
  • Total vector size (bp) 6244
  • Modifications to backbone
    The ET8 vector was modified from the commercial vector pIRES2-EGFP from BD Biosciences.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human platelet membrane protein GPIb alpha 1-290aa
  • Alt name
    GPIba
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    870
  • Entrez Gene
    GP1BA (a.k.a. BDPLT1, BDPLT3, BSS, CD42B, CD42b-alpha, DBPLT3, GP1B, GPIbA, GPIbalpha, VWDP)
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • 6xHis tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer TCTCGACACCCTTCTCCTCCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ET8-GPIba-6His was a gift from Timothy Springer (Addgene plasmid # 102878 ; http://n2t.net/addgene:102878 ; RRID:Addgene_102878)

  • For your References section:

    Flow-induced elongation of von Willebrand factor precedes tension-dependent activation. Fu H, Jiang Y, Yang D, Scheiflinger F, Wong WP, Springer TA. Nat Commun. 2017 Aug 23;8(1):324. doi: 10.1038/s41467-017-00230-2. 10.1038/s41467-017-00230-2 [pii] PubMed 28831047
Related items:
Commonly requested with: