PresentER-MSIIFFLPL (GFP)
(Plasmid
#102946)
-
PurposePresentER minigene encoding H2-Kb ligand MSIIFFLPL (GFP)
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePresentER
- Backbone size w/o insert (bp) 8300
- Total vector size (bp) 8311
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMSIIFFLPL
-
Alt namePigment epithelium-derived factor H2-Kd epitope 257-264
-
Alt namePEDF 271–279
-
Alt nameSerpinf1 271-279
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)27
-
GenBank IDNM_011340.3
-
Entrez GeneSerpinf1 (a.k.a. AI195227, EPC-1, Pedf, Pedfl, Sdf3)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer GTTCGACCCCGCCTCGATCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PresentER-MSIIFFLPL (GFP) was a gift from David Scheinberg (Addgene plasmid # 102946 ; http://n2t.net/addgene:102946 ; RRID:Addgene_102946) -
For your References section:
Rejection of immunogenic tumor clones is limited by clonal fraction. Gejman RS, Chang AY, Jones HF, DiKun K, Hakimi AA, Schietinger A, Scheinberg DA. Elife. 2018 Nov 30;7. pii: 41090. doi: 10.7554/eLife.41090. 10.7554/eLife.41090 PubMed 30499773