Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PresentER-SIINFEKL (mCherry)
(Plasmid #102945)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 102945 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 8321
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin ; mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Chicken Ovalbumin H2-Kd epitope 257-264
  • Alt name
  • Alt name
  • Species
    G. gallus (chicken), Synthetic
  • Insert Size (bp)
  • Mutation
  • Entrez Gene
    OVAL (a.k.a. OVA, SERPINB14)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GTTCGACCCCGCCTCGATCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PresentER-SIINFEKL (mCherry) was a gift from David Scheinberg (Addgene plasmid # 102945 ; ; RRID:Addgene_102945)
  • For your References section:

    Rejection of immunogenic tumor clones is limited by clonal fraction. Gejman RS, Chang AY, Jones HF, DiKun K, Hakimi AA, Schietinger A, Scheinberg DA. Elife. 2018 Nov 30;7. pii: 41090. doi: 10.7554/eLife.41090. 10.7554/eLife.41090 PubMed 30499773