-
PurposeEncodes Ebola virus minigenome with EGFP reporter gene. Minigenome is under control of the CAG promoter
-
Depositing Lab
-
Depositing OrganizationBoston University Medical Campus
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 103054-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 103054-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGs
- Total vector size (bp) 6855
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEbola virus (ebolavirus Zaire, Mayinga) minigenome
-
Speciesebolavirus Zaire, Mayinga
-
Insert Size (bp)4754
- Promoter CAG
-
Tag
/ Fusion Protein
- 3E5E eGFP cloned into pCAGGS vector from pCDNA3.1 3E5E eGFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 103054-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 103054-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS_3E5E_eGFP was a gift from Elke Mühlberger (Addgene plasmid # 103054 ; http://n2t.net/addgene:103054 ; RRID:Addgene_103054) -
For your References section:
An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening. Nelson EV, Pacheco JR, Hume AJ, Cressey TN, Deflube LR, Ruedas JB, Connor JH, Ebihara H, Muhlberger E. Antiviral Res. 2017 Aug 12;146:21-27. doi: 10.1016/j.antiviral.2017.08.005. 10.1016/j.antiviral.2017.08.005 PubMed 28807685