Skip to main content
Addgene
Open Menu

eGFP-KCC2
(Plasmid #104075)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104075 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 104075-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 104075-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 8157
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KCC2 (b isoform)
  • Alt name
    Slc12a5
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3350
  • Mutation
    EcoR1 site in rat KCC2 was removed by silent mutation, A3267G in rat coding sequence
  • Entrez Gene
    Slc12a5 (a.k.a. Kcc2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer EGFP-C . CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eGFP-KCC2 was a gift from Igor Medyna (Addgene plasmid # 104075 ; http://n2t.net/addgene:104075 ; RRID:Addgene_104075)

  • For your References section:

    Knocking down of the KCC2 in rat hippocampal neurons increases intracellular chloride concentration and compromises neuronal survival. Pellegrino C, Gubkina O, Schaefer M, Becq H, Ludwig A, Mukhtarov M, Chudotvorova I, Corby S, Salyha Y, Salozhin S, Bregestovski P, Medina I. J Physiol. 2011 May 15;589(Pt 10):2475-96. doi: 10.1113/jphysiol.2010.203703. Epub 2011 Mar 21. 10.1113/jphysiol.2010.203703 PubMed 21486764
Related items:
Commonly requested with: