Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCITF-KCC2
(Plasmid #61404)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61404 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCITF
  • Backbone size w/o insert (bp) 6900
  • Total vector size (bp) 10292
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KCC2
  • Alt name
    SLC12A5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3351
  • GenBank ID
    AAG43493.1 AF208159.1
  • Entrez Gene
    SLC12A5 (a.k.a. EIEE34, EIG14, KCC2, hKCC2)
  • Promoter CAG
  • Tag / Fusion Protein
    • IRES-tdTomato-Flag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer CTACAGCTCCTGGGCAACGT
  • 3′ sequencing primer CGGCTTCGGCCAGTAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCITF-KCC2 was a gift from Franck Polleux (Addgene plasmid # 61404 ; http://n2t.net/addgene:61404 ; RRID:Addgene_61404)
  • For your References section:

    KCC2 expression promotes the termination of cortical interneuron migration in a voltage-sensitive calcium-dependent manner. Bortone D, Polleux F. Neuron. 2009 Apr 16;62(1):53-71. doi: 10.1016/j.neuron.2009.01.034. 10.1016/j.neuron.2009.01.034 PubMed 19376067