myc-hIFITM3-F63Q
(Plasmid
#104363)
-
PurposeExpresses human IFITM3-F63Q with an N-terminal myc tag in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationOhio State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 104363-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 104363-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4202
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)402
-
Mutationmutated the following amino acid: F63Q
-
Entrez GeneIFITM3 (a.k.a. 1-8U, DSPA2b, IP15)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Sal1 (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 104363-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 104363-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
myc-hIFITM3-F63Q was a gift from Jacob Yount (Addgene plasmid # 104363 ; http://n2t.net/addgene:104363 ; RRID:Addgene_104363) -
For your References section:
IFITM3 requires an amphipathic helix for antiviral activity. Chesarino NM, Compton AA, McMichael TM, Kenney AD, Zhang L, Soewarna V, Davis M, Schwartz O, Yount JS. EMBO Rep. 2017 Oct;18(10):1740-1751. doi: 10.15252/embr.201744100. Epub 2017 Aug 23. 10.15252/embr.201744100 PubMed 28835547