pAAV-EF1a-FLEX-SOUL-P2A-tdTomato-WPRE-BGHpA
(Plasmid #177577)

• Purpose: Expresses SOUL in Cre-positive cells
• Depositing Lab: Guoping Feng
• Publication: Gong et al Neuron. 2020 Jul 8;107(1):197. doi: 10.1016/j.neuron.2020.06.018.

Backbone

• Vector backbone: pAAV
• Total vector size (bp): 7753
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SOUL
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 927
• Promoter: EF1a
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: atacacccgatggctgagac
• 3′ sequencing primer: gtctcagccatcgggtgtat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SOUL is a combination of the stabilized step-function opsin (SSFO) mutations C128S and D156A with the T159C mutation in channelrhodopsin previously reported by Dr. Karl Deisseroth et. al.