pAAV-EF1a-FLEX-SOUL-P2A-tdTomato-WPRE-BGHpA
(Plasmid
#177577)
-
PurposeExpresses SOUL in Cre-positive cells
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7753
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOUL
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)927
- Promoter EF1a
-
Tag
/ Fusion Protein
- tdTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer atacacccgatggctgagac
- 3′ sequencing primer gtctcagccatcgggtgtat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SOUL is a combination of the stabilized step-function opsin (SSFO) mutations C128S and D156A with the T159C mutation in channelrhodopsin previously reported by Dr. Karl Deisseroth et. al.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-FLEX-SOUL-P2A-tdTomato-WPRE-BGHpA was a gift from Guoping Feng (Addgene plasmid # 177577 ; http://n2t.net/addgene:177577 ; RRID:Addgene_177577) -
For your References section:
An Ultra-Sensitive Step-Function Opsin for Minimally Invasive Optogenetic Stimulation in Mice and Macaques. Gong X, Mendoza-Halliday D, Ting JT, Kaiser T, Sun X, Bastos AM, Wimmer RD, Guo B, Chen Q, Zhou Y, Pruner M, Wu CW, Park D, Deisseroth K, Barak B, Boyden ES, Miller EK, Halassa MM, Fu Z, Bi G, Desimone R, Feng G. Neuron. 2020 Jul 8;107(1):197. doi: 10.1016/j.neuron.2020.06.018. 10.1016/j.neuron.2020.06.018 PubMed 32645306