pTEI039
(Plasmid
#105428)
-
PurposeSynthetic biology
-
Depositing Lab
-
Depositing OrganizationMartin-Luther-Universitaet Halle-Wittenberg
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105428-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105428-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepICH41308 (Engler et al., 2014)
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLexA-VP16-ER (transcription factor: inducible expression; estradiol)
-
SpeciesSynthetic
-
MutationBsaI/ BpiI restriction sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer CTTTGAGTGAGCTGATACCG
- 3′ sequencing primer GGGTTCCGCGCACATTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 105428-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105428-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTEI039 was a gift from Johannes Stuttmann (Addgene plasmid # 105428 ; http://n2t.net/addgene:105428 ; RRID:Addgene_105428) -
For your References section:
Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system. Gantner J, Ordon J, Ilse T, Kretschmer C, Gruetzner R, Lofke C, Dagdas Y, Burstenbinder K, Marillonnet S, Stuttmann J. PLoS One. 2018 May 30;13(5):e0197185. doi: 10.1371/journal.pone.0197185. eCollection 2018. 10.1371/journal.pone.0197185 PubMed 29847550