This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mCherry-CRY2clust
(Plasmid #105624)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105624 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4658
  • Total vector size (bp) 6179
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry-CRY2PHR-9aa
  • Alt name
    mCherry-CRY2clust
  • Alt name
    839529
  • Species
    H. sapiens (human), A. thaliana (mustard weed)
  • Insert Size (bp)
    1521
  • Entrez Gene
    CRY2 (a.k.a. AT1G04400, AT-PHH1, ATCRY2, CRYPTOCHROME 2 APOPROTEIN, F19P19.14, F19P19_14, FHA, PHH1, cryptochrome 2)
  • Promoter CMV
  • Tag / Fusion Protein
    • 9 amino acids (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer ATGAAGATGGACAAAAAGACCATCGTCTGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-CRY2clust was a gift from Won_Do Heo (Addgene plasmid # 105624 ; http://n2t.net/addgene:105624 ; RRID:Addgene_105624)
  • For your References section:

    Optogenetic protein clustering through fluorescent protein tagging and extension of CRY2. Park H, Kim NY, Lee S, Kim N, Kim J, Heo WD. Nat Commun. 2017 Jun 23;8(1):30. doi: 10.1038/s41467-017-00060-2. 10.1038/s41467-017-00060-2 PubMed 28646204