-
PurposeDouble fluorescent stalling reporter K0
-
Depositing Lab
-
Depositing OrganizationMRC Laboratory of Molecular Biology
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105686 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105686-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105686-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6006
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameP2A-3xFLAG-VHPbeta
-
SpeciesSynthetic
-
Insert Size (bp)479
- Promoter CMV (from vector)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
- 3′ sequencing primer ACAGGATGTCCCAGGCGAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameK0
-
Insert Size (bp)43
- Promoter CMV (from vector)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
- 3′ sequencing primer ACAGGATGTCCCAGGCGAA
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameP2A-mCherry
-
Insert Size (bp)795
- Promoter CMV (from vector)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
- 3′ sequencing primer ACCACAACTAGAATGCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 105686-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105686-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmGFP-P2A-K0-P2A-RFP was a gift from Ramanujan Hegde (Addgene plasmid # 105686 ; http://n2t.net/addgene:105686 ; RRID:Addgene_105686) -
For your References section:
Initiation of Quality Control during Poly(A) Translation Requires Site-Specific Ribosome Ubiquitination. Juszkiewicz S, Hegde RS. Mol Cell. 2017 Feb 16;65(4):743-750.e4. doi: 10.1016/j.molcel.2016.11.039. Epub 2017 Jan 5. 10.1016/j.molcel.2016.11.039 PubMed 28065601