Skip to main content

pmGFP-P2A-K0-P2A-RFP
(Plasmid #105686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105686 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 105686-D50 50 μg of DNA in Tris buffer $495
DNA 105686-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6006
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    P2A-3xFLAG-VHPbeta
  • Species
    Synthetic
  • Insert Size (bp)
    479
  • Promoter CMV (from vector)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
  • 3′ sequencing primer ACAGGATGTCCCAGGCGAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    K0
  • Insert Size (bp)
    43
  • Promoter CMV (from vector)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
  • 3′ sequencing primer ACAGGATGTCCCAGGCGAA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    P2A-mCherry
  • Insert Size (bp)
    795
  • Promoter CMV (from vector)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
  • 3′ sequencing primer ACCACAACTAGAATGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmGFP-P2A-K0-P2A-RFP was a gift from Ramanujan Hegde (Addgene plasmid # 105686 ; http://n2t.net/addgene:105686 ; RRID:Addgene_105686)
  • For your References section:

    Initiation of Quality Control during Poly(A) Translation Requires Site-Specific Ribosome Ubiquitination. Juszkiewicz S, Hegde RS. Mol Cell. 2017 Feb 16;65(4):743-750.e4. doi: 10.1016/j.molcel.2016.11.039. Epub 2017 Jan 5. 10.1016/j.molcel.2016.11.039 PubMed 28065601