Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmGFP-P2A-K(AAA)20-P2A-RFP
(Plasmid #105688)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105688 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6030
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    P2A-3xFLAG-VHPbeta
  • Species
    Synthetic
  • Insert Size (bp)
    479
  • Promoter CMV (from vector)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
  • 3′ sequencing primer ACAGGATGTCCCAGGCGAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    K(AAA)20
  • Insert Size (bp)
    103
  • Promoter CMV (from vector)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
  • 3′ sequencing primer ACAGGATGTCCCAGGCGAA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    P2A-mCherry
  • Insert Size (bp)
    795
  • Promoter CMV (from vector)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
  • 3′ sequencing primer ACCACAACTAGAATGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmGFP-P2A-K(AAA)20-P2A-RFP was a gift from Ramanujan Hegde (Addgene plasmid # 105688 ; http://n2t.net/addgene:105688 ; RRID:Addgene_105688)
  • For your References section:

    Initiation of Quality Control during Poly(A) Translation Requires Site-Specific Ribosome Ubiquitination. Juszkiewicz S, Hegde RS. Mol Cell. 2017 Feb 16;65(4):743-750.e4. doi: 10.1016/j.molcel.2016.11.039. Epub 2017 Jan 5. 10.1016/j.molcel.2016.11.039 PubMed 28065601