Skip to main content

pRPF144
(Plasmid #106372)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106372 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 106372-D50 50 μg of DNA in Tris buffer $495
DNA 106372-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMTL960
  • Backbone size w/o insert (bp) 6218
  • Total vector size (bp) 8258
  • Vector type
    E. coli - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 15 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Low copy in C. difficile following conjugation and selected with thiamphenicol
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pcwp2-gusA
  • Insert Size (bp)
    2040
  • Mutation
    codon optimised for C. difficile
  • Entrez Gene
    gusA (a.k.a. ECO111_2086)
  • Promoter Pcwp2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CACCTCCTTTTTGACTTTAAGCCTACGAATACC
  • 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRPF144 was a gift from Robert Fagan & Neil Fairweather (Addgene plasmid # 106372 ; http://n2t.net/addgene:106372 ; RRID:Addgene_106372)
  • For your References section:

    Clostridium difficile has two parallel and essential Sec secretion systems. Fagan RP, Fairweather NF. J Biol Chem. 2011 Aug 5;286(31):27483-93. doi: 10.1074/jbc.M111.263889. Epub 2011 Jun 9. 10.1074/jbc.M111.263889 PubMed 21659510