Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #106377)


Item Catalog # Description Quantity Price (USD)
Plasmid 106377 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6191
  • Total vector size (bp) 9231
  • Vector type
    E. coli - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 15 ug/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Low copy in C. difficile following conjugation and selected with thiamphenicol
  • Copy number
    High Copy


  • Gene/Insert name
  • Insert Size (bp)
  • Mutation
    Codon optimised for C. difficile
  • Promoter Ptet

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BstXI (not destroyed)
  • 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRPF215 was a gift from Robert Fagan & Neil Fairweather (Addgene plasmid # 106377 ; ; RRID:Addgene_106377)
  • For your References section:

    High-throughput analysis of gene essentiality and sporulation in Clostridium difficile. Dembek M, Barquist L, Boinett CJ, Cain AK, Mayho M, Lawley TD, Fairweather NF, Fagan RP. MBio. 2015 Feb 24;6(2):e02383. doi: 10.1128/mBio.02383-14. 10.1128/mBio.02383-14 PubMed 25714712