pJAK184
(Plasmid
#167281)
-
Purpose(Empty Backbone) MazF-based mutagenesis vector for C. difficile
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMTLSC-7215
-
Backbone manufacturerNigel P Minton
- Backbone size (bp) 6768
-
Modifications to backbonePlasmid pJAK112 (Addgene Plasmid 167280) was modified to replace the codA gene with a xylose-inducible mazF. The xylB promoter and adjacent xylR (Pxyl) were amplified from C. difficile strain R20291 using oligonucleotides RF1589 (GATCGGTACCGGTTATGGCTGTATATAGTCATAAC) and RF1590 (GATCGAGCTCGAATGCCACTTCATAACTATCGTTTTC) and inserted into pRPF185 using KpnI/SacI restriction-ligation. E. coli mazF was codon optimised for C. difficile, synthesised (FragmentGENE by Genewiz) and inserted into the resulting plasmid via SacI/BamHI restriction-ligation. Pxly-mazF was then amplified using oligonucleotides RF1704 (GATCGCGGCCGCGCTGTATATAGTCATAACCCTTATATTTC) and RF1705 (GATCCTCGAGGAGAGTTGTTGATTTATCCAATTAATAC) and inserted into pJAK112 using NotI/XhoI restriction-ligation resulting in pJAK183. The SacI site upstream of mazF was then removed by inverse PCR (RF1718, GCCACTTCATAACTATCGTTTTCC / RF1719, GCAGTAAAGGAGAAAATTTTATGGTAAG) resulting in pJAK184.
-
Vector typeE. coli - C. difficile shuttle vector
- Promoter Pxyl
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow copy in C. difficile following conjugation and selected with thiamphenicol
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJAK184 was a gift from Robert Fagan (Addgene plasmid # 167281 ; http://n2t.net/addgene:167281 ; RRID:Addgene_167281) -
For your References section:
An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, Fagan RP, Barquist L, Vogel J, Faber F. Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118. 10.1073/pnas.2103579118 PubMed 34131082