gh126
(Plasmid
#106796)
-
Purposeexpression of gRNA targeting ST8SIA6
-
Depositing Lab
-
Depositing OrganizationUniversity of Copenhagen
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 106796-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 106796-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneEPB104
-
Backbone manufacturerEric-Paul Bennett (Addgene plasmid # 68369)
- Backbone size w/o insert (bp) 2376
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameST8SIA6
-
gRNA/shRNA sequenceGGAGCGTCCTCAGCGCTGCG
-
SpeciesH. sapiens (human)
-
Entrez GeneST8SIA6 (a.k.a. SIA8F, SIAT8-F, SIAT8F, ST8SIA-VI, ST8SiaVI)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer T7NP
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 106796-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 106796-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gh126 was a gift from Eric-Paul Bennett (Addgene plasmid # 106796 ; http://n2t.net/addgene:106796 ; RRID:Addgene_106796) -
For your References section:
A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome. Narimatsu Y, Joshi HJ, Zhang Y, Gomes C, Chen YH, Lorenzetti F, Furukawa S, Schjoldager K, Hansen L, Clausen H, Bennett EP, Wandall HH. Glycobiology. 2018 Jan 5. pii: 4791732. doi: 10.1093/glycob/cwx101. 10.1093/glycob/cwx101 PubMed 29315387