Skip to main content
Addgene
Open Menu

pTRE-T2-IRES-His6-Ubiquitin
(Plasmid #107107)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107107 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 107107-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 107107-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pTRE-T2-delta-miR-IRES
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4857
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human ubiquitin UBB
  • Alt name
    UBB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    258
  • GenBank ID
    Gene ID: 7314
  • Entrez Gene
    UBB (a.k.a. HEL-S-50)
  • Promoter Tet
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer IRES internal sequencing primer #1: GAAGCAGTTCCTCTGGAAGC and IRES internal sequencing primer #2: GTATGGGATCTGATCTGGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

XbaI site at 3' His6 Ubiquitin is methylation sensitive

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-T2-IRES-His6-Ubiquitin was a gift from Michael E. Wright (Addgene plasmid # 107107 ; http://n2t.net/addgene:107107 ; RRID:Addgene_107107)
Related items:
Commonly requested with: