Skip to main content
Addgene
Open Menu

pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA
(Plasmid #107270)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107270 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 107270-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 107270-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    N/A
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    hSpCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4101
  • Promoter TRE
  • Tags / Fusion Proteins
    • 3xFlag (N terminal on insert)
    • Nucleoplasmin NLS (C terminal on insert)
    • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    rtTA
  • Insert Size (bp)
    747
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer caattacggggtcattagttcatag
  • 3′ sequencing primer gggagcatgtcaaggtcaaaatc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    bGH polyA-SV40polyA
  • Insert Size (bp)
    416

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Puro-Cas9 donor vector (Addgene #58409)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA was a gift from Pablo Menéndez (Addgene plasmid # 107270 ; http://n2t.net/addgene:107270 ; RRID:Addgene_107270)

  • For your References section:

    Generation and characterization of a human iPSC cell line expressing inducible Cas9 in the "safe harbor" AAVS1 locus. Castano J, Bueno C, Jimenez-Delgado S, Roca-Ho H, Fraga MF, Fernandez AF, Nakanishi M, Torres-Ruiz R, Rodriguez-Perales S, Menendez P. Stem Cell Res. 2017 May;21:137-140. doi: 10.1016/j.scr.2017.04.011. Epub 2017 Apr 22. 10.1016/j.scr.2017.04.011 PubMed 28677529
Related items:
Commonly requested with: