cacnb1b (rat) in pMT2 vector
(Plasmid
#107423)
-
PurposeExpresses Calcium channel beta1b auxillary subunit in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationUniversity College London
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 107423-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 107423-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMT2
-
Backbone manufacturerGenetics Institute, Inc, Cambridge, MA, USA
- Backbone size w/o insert (bp) 5163
- Total vector size (bp) 7734
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecalcium channel beta1b auxillary subunit
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2599
- Promoter Ad MLP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr Terry P. Snutch, The University of British Columbia, Vancouver, B.C., Canada
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note, although not a perfect match, the nucleotide sequence of this plasmid most closely matches NM_017346.1 Rattus norvegicus cacnb1 mRNA.
DNA (Catalog # 107423-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 107423-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacnb1b (rat) in pMT2 vector was a gift from Annette Dolphin (Addgene plasmid # 107423 ; http://n2t.net/addgene:107423 ; RRID:Addgene_107423) -
For your References section:
The intracellular loop between domains I and II of the B-type calcium channel confers aspects of G-protein sensitivity to the E-type calcium channel. Page KM, Stephens GJ, Berrow NS, Dolphin AC. J Neurosci. 1997 Feb 15;17(4):1330-8. PubMed 9006976