cacnb1b (rat) in pMT2 vector
(Plasmid #107423)

• Purpose: Expresses Calcium channel beta1b auxillary subunit in mammalian cells.
• Depositing Lab: Annette Dolphin
• Publication: Page et al J Neurosci. 1997 Feb 15;17(4):1330-8.

Backbone

• Vector backbone: pMT2
• Backbone manufacturer: Genetics Institute, Inc, Cambridge, MA, USA
• Backbone size w/o insert (bp): 5163
• Total vector size (bp): 7734
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: calcium channel beta1b auxillary subunit
• Species: R. norvegicus (rat)
• Insert Size (bp): 2599
• Promoter: Ad MLP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGCTTGAGGTGTGGCAGGCTT
• 3′ sequencing primer: GGTCGAACCATGATGGCAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr Terry P. Snutch, The University of British Columbia, Vancouver, B.C., Canada
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note, although not a perfect match, the nucleotide sequence of this plasmid most closely matches NM_017346.1 Rattus norvegicus cacnb1 mRNA.