pMT2 Beta1b mCherry
(Plasmid #89892)

• Purpose: Mammalian expression of Beta1b mCherry
• Depositing Lab: Annette Dolphin
• Depositing Organization: University College London
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Page et al J Biol Chem. 2016 Sep 23;291(39):20402-16. doi: 10.1074/jbc.M116.737270. Epub 2016 Aug 3.

Backbone

• Vector backbone: pMT2
• Backbone size w/o insert (bp): 5129
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cacnb1
• Alt name: Beta1b
• Species: R. norvegicus (rat)
• Insert Size (bp): 2658
• Mutation: mCherry sequence inserted just before the Stop codon
• Entrez Gene: Cacnb1 (a.k.a. CAB1)
• Promoter: adenovirus major late promoter
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: 5' agcttgaggtgtggcaggctt 3'
• 3′ sequencing primer: 5' ggtcgaaccatgatggcagc 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cut out B1b with EcoRI and SpeI (but then you lose the start codon), cut out mCherry with SpeI and NotI (but then you lose the Stop codon). The mCherry is missing the N-terminal start codon. The SpeI site introduces 2 extra amino acids: Threonine and serine. Cut out the entire insert with EcoRI and NotI.

DNA (Catalog # 89892-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 89892-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.