pMT2 Beta1b GFP
(Plasmid #89893)

• Purpose: Mammalian expression of Beta1b GFP
• Depositing Lab: Annette Dolphin
• Publication: Page et al J Biol Chem. 2016 Sep 23;291(39):20402-16. doi: 10.1074/jbc.M116.737270. Epub 2016 Aug 3.

Backbone

• Vector backbone: pMT2
• Backbone size w/o insert (bp): 5129
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cacnb1
• Alt name: Beta1b
• Species: R. norvegicus (rat)
• Insert Size (bp): 2662
• Mutation: GFP sequence inserted just before the Stop codon
• Entrez Gene: Cacnb1 (a.k.a. CAB1)
• Promoter: adenovirus major late promoter
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: 5' agcttgaggtgtggcaggctt 3'
• 3′ sequencing primer: 5' ggtcgaaccatgatggcagc 3'

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry