cacnb2a (rat) in pMT2 vector
(Plasmid #107424)

• Purpose: Expresses Calcium channel beta2a auxillary subunit in mammalian cells
• Depositing Lab: Annette Dolphin
• Publication: Wyatt et al J Physiol. 1998 Jul 15;510 ( Pt 2):347-60.

Backbone

• Vector backbone: pMT2
• Backbone size w/o insert (bp): 5163
• Total vector size (bp): 7641
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: calcium channel beta2a auxillary subunit
• Species: R. norvegicus (rat)
• Insert Size (bp): 2506
• GenBank ID: NM_053851
• Entrez Gene: Cacnb2 (a.k.a. Cacnlb2)
• Promoter: Ad MLP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGCTTGAGGTGTGGCAGGCTT
• 3′ sequencing primer: GGTCGAACCATGATGGCAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr Edward Perez-Reyes,Stritch School of Medicine, Dept of Physiology, Loyola University Chicago, Illinois, USA
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We received it in pBluescript and subcloned it into pMT2 plasmid.