eMscL WT
(Plasmid
#107454)
-
PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motif
-
Depositing Lab
-
Depositing OrganizationFondazione Istituto Italiano di Tecnologia
Located in Italy -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 107454-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 107454-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepAAV2
- Total vector size (bp) 6513
-
Vector typeMammalian Expression ; Adeno-associated viral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebacterial mechanosensitive ion channel of large conductance
-
Alt namemscL
-
SpeciesEscherichia Coli
-
Insert Size (bp)411
-
Entrez GenemscL (a.k.a. b3291, ECK3277, yhdC)
- Promoter human synapsin 1
-
Tags
/ Fusion Proteins
- tdTomato fluorescence protein (C terminal on insert)
- Kir2.1 ER export signal (FCYENEV) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer 5’ - CTGCCTCAGTCTGCGGTGGG - 3’
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 107454-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 107454-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eMscL WT was a gift from Francesco Difato (Addgene plasmid # 107454 ; http://n2t.net/addgene:107454 ; RRID:Addgene_107454) -
For your References section:
Mechano-sensitization of mammalian neuronal networks through expression of the bacterial mechanosensitive MscL channel. Soloperto A, Boccaccio A, Contestabile A, Moroni M, Hallinan GI, Palazzolo G, Chad J, Deinhardt K, Carugo D, Difato F. J Cell Sci. 2018 Jan 29. pii: jcs.210393. doi: 10.1242/jcs.210393. 10.1242/jcs.210393 PubMed 29361543