Skip to main content
Addgene
Open Menu

pCI-TPI_WT-IL6_3UTR-xrRNA-4H
(Plasmid #108373)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108373 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 108373-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 108373-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCI-neo
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Wild type TPI reporter with partial IL6 control 3' UTR, MVE xrRNA and 4H probe binding sites
  • Species
    H. sapiens (human)
  • Entrez Gene
    TPI1 (a.k.a. HEL-S-49, TIM, TPI, TPID)
  • Entrez Gene
    IL6 (a.k.a. BSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GGTGTCCACTCCCAGTTCA
  • 3′ sequencing primer TGCATTCTAGTTGTGGTTTGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-TPI_WT-IL6_3UTR-xrRNA-4H was a gift from Niels Gehring (Addgene plasmid # 108373 ; http://n2t.net/addgene:108373 ; RRID:Addgene_108373)

  • For your References section:

    Interrogating the degradation pathways of unstable mRNAs with XRN1-resistant sequences. Boehm V, Gerbracht JV, Marx MC, Gehring NH. Nat Commun. 2016 Dec 5;7:13691. doi: 10.1038/ncomms13691. 10.1038/ncomms13691 PubMed 27917860
Related items:
Commonly requested with: