EcPPK1
(Plasmid
#108850)
-
PurposeExpresses E. coli PPK1 in mammalian cell lines
-
Depositing Lab
-
Depositing OrganizationUniversity of Ottawa
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 108850-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 108850-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1(-)
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7472
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePolyphosphate Kinase 1
-
Alt namePPK1
-
SpeciesE. coli
-
Insert Size (bp)2067
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCACCACACTGGACTAGTGATGGGTCAGGAAAAGCTATAC
- 3′ sequencing primer TGATCAGCGGTTTAAACTTATTATTCAGGTTGTTCGAGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPPK origin is Université de Lausanne
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 108850-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 108850-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EcPPK1 was a gift from Michael Downey (Addgene plasmid # 108850 ; http://n2t.net/addgene:108850 ; RRID:Addgene_108850) -
For your References section:
A Screen for Candidate Targets of Lysine Polyphosphorylation Uncovers a Conserved Network Implicated in Ribosome Biogenesis. Bentley-DeSousa A, Holinier C, Moteshareie H, Tseng YC, Kajjo S, Nwosu C, Amodeo GF, Bondy-Chorney E, Sai Y, Rudner A, Golshani A, Davey NE, Downey M. Cell Rep. 2018 Mar 27;22(13):3427-3439. doi: 10.1016/j.celrep.2018.02.104. 10.1016/j.celrep.2018.02.104 PubMed 29590613