Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET GFP LIC cloning vector (u-msfGFP)
(Plasmid #29772)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29772 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 5481
  • Modifications to backbone
    The GFP is the version described in Pedelacq et. al. (Jan 2006, Nature Biotechnology). The following mutations are included: F100S, M154T, V164A, S30R, Y39N, N105T, Y145F, I171V and A206K. These mutations have been shown to enhance brightness and solubility, and to inhibit dimerization.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site vuGFP (destroyed during cloning)
  • 3′ cloning site LIC site vuGFP (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer GFP reverse (5'gcaccttgaagcgcatgaact)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.

GFP has a excitation max of 489 nm and an emission max of 510 nm.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TTTAAGAAGGAGATATAGATC3'

Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with EcoRV, then gel purify.

When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET GFP LIC cloning vector (u-msfGFP) was a gift from Scott Gradia (Addgene plasmid # 29772 ; http://n2t.net/addgene:29772 ; RRID:Addgene_29772)